Transgenic and Knock-in Mouse Lines

Case ID:
C14590

Title: Transgenic and Knock-in Mouse Lines

JHU Ref: C14590

 

Mice available at Jackson Laboratory https://www.jax.org/

 

Mouse Strains and Descriptions

1.       Stock # 026005  B6;129-Gt(ROSA)26Sortm9(CAG-GFP*)Nat/J                   

Detailed Description

Gt(ROSA)26Sor (R26) mLSL-nGFP mice incorporate a nuclear-localization signal (nls)-GFP open reading frame inserted downstream of a loxP-stop-loxP cassette in which one loxP site is wild type and the other is mutant loxP63 (mutant-LSL or "mLSL"). The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences.

 

When crossed with Cre-expressing strains, the result is reduced efficiency of Cre-mediated recombination. There is no background recombination in the absence of 4-hydroxytamoxifen (4HT) when tested with typical CreER lines. These mice will be useful for applications that require extremely sparse labeling, such as lineage tracing. Mice homozygous for this allele are viable and fertile with no obvious physical or behavioral abnormalities.   

 

Development

A targeting vector containing (from 5' to 3') a CAG promoter, a mutant loxP63 (ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized GFP with a C-terminal 6-Myc epitope tag, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette was inserted into the Gt(ROSA)26Sor locus. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences. The construct was electroporated into 129-derived ES cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Resulting chimeric males were crossed to C57BL/6 mice for two generations by the donating laboratory.

 

2.       Stock # 026006  B6;129-Gt(ROSA)26Sortm7(CAG-tdTomato*)Nat/J

Detailed Description

Gt(ROSA)26Sor (R26) mLSL-ntdT mice incorporate a nuclear-localization signal (nls)-tandem dimer Tomato ("tdT") open reading frame downstream of a floxed stop cassette involving one wildtype loxP site and one mutant loxP63 site (mutant-LSL or "mLSL"). The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences.

 

When crossed with Cre-expressing strains, the result is reduced efficiency of Cre-mediated recombination. There is no background recombination in the absence of 4-hydroxytamoxifen (4HT) when tested with typical CreER lines. These mice will be useful for applications that require extremely sparse labeling, such as lineage tracing. Mice homozygous for this allele are viable and fertile with no obvious physical or behavioral abnormalities.

 

Development

A targeting vector containing (from 5' to 3') a CAG promoter, a mutant loxP63(ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized tdTomato with a C-terminal triple hemagglutinin (HA) epitope, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette was inserted into the Gt(ROSA)26Sor locus. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences. The construct was electroporated into 129-derived ES cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Resulting chimeric males were crossed to C57BL/6 mice for two generations by the donating laboratory.

 

3.       Stock # 026007  B6;129-Gt(ROSA)26Sortm8(cre/Esr1*)Nat/J      

Detailed Description

A Mer-Cre-Mer open reading frame (i.e. mouse estrogen receptor (MER) ligand binding domains, mutated to recognize tamoxifen rather than estrogen (ER(T)), fused at both the amino and carboxy termini of a central Cre domain) was inserted at the Gt(ROSA)26Sor locus downstream of an internal ribosome entry site (IRES). The IRESreduces translation efficiency and the presence of two ER(T) domains improves cytoplasmic retention in the absence of 4-hydroxytamoxifen (4HT). The result is very low (undetectable) Cre-mediated recombination in the absence of 4HT, even with highly recombinogenic loxP targets. These mice will be useful for applications that require extremely sparse labeling, such as lineage tracing. Mice homozygous for this allele are viable and fertile with no obvious physical or behavioral abnormalities.

 

Development

A targeting vector containing (from 5' to 3') a splice acceptor, IRES, Mer-Cre-Mer, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette was inserted into the Gt(ROSA)26Sor locus. The MerCreMer double fusion protein has a Cre recombinase cDNA sequence flanked on each end with a mutated murine estrogen receptor (mer) ligand binding domain (amino acids 281-599, G525R), thus rendering Cre expression tamoxifen-inducible yet estrogen-insensitive. The construct was electroporated into 129-derived ES cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Resulting chimeric males were crossed to C57BL/6 mice twice by the donating lab.

               

4.       Stock # 026008  STOCK Fzd6tm2.1Nat/J 

Detailed Description

Fzd6 (frizzled homolog 6 (Drosophila); also called Fz6) is a member of the frizzled family of genes that encode receptors for Wnt signaling proteins.

 

This Fzd6 conditional allele functions as a wildtype allele in the absence of Cre-mediated recombination. Exon 4 is flanked by loxP sites. Upon germline Cre-mediated recombination, the deletion allele appears to be a null allele as judged by the pattern of hair mis-orientation, which is indistinguishable from the pattern seen with a conventional null allele.

 

Development

LoxP sites were inserted into introns 3 and 4 of the Fzd6 gene, flanking exon 4 (the largest coding exon in the gene). A Frt-neo-Frt cassette that was used for positive selection was introduced adjacent to the loxP site in intron 3. The targeting construct was electroporated into 129-derived embryonic stem (ES) cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Resulting chimeric males were crossed to C57BL/6 mice. The Frt-flanked neo was removed by germline Flp-mediated recombination. This strain was backcrossed to C57BL/6 for two generations by the donating lab.       

                                   

5.       Stock # 028316 STOCK Fzd9tm1.1Nat/J

Detailed Description

Fzd9 (frizzled homolog 9 (Drosophila)) coding region sequences are flanked by loxP sites in this Fzd9-CKO-AP allele. Cre-mediated recombination of the floxed region creates a knockout of the gene and enables expression of the alkaline phosphatase coding region under the control of the Fzd9 promoter.

 

Homozygous floxed mice have no apparent phenotype and are healthy and fertile. Expression of Fzd9 mRNA and protein have not been examined directly. Expression of the conditional reporter (alkaline phosphatase) has been examined histochemically.

 

Development

LoxP sites were inserted (1) within the first coding exon 5' of the initiator methionine codon, and (2) 3' of an SV40 polyadenylation signal that was inserted immediately 3' of the 3' UTR. The following DNA segments were added immediately downstream of the 3' loxP site: (1) the coding region for human placental alkaline phosphatase (AP), and (2) a phosphoglycerate kinase (PGK)-Neo cassette flanked by FRT sites (FNF). The targeting construct was electroporated into 129-derived ES cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Resulting chimeric males were crossed to C57BL/6 mice and then germline Flp mice (see Stock No. 003800) to excise the FRT-PGK-Neo-FRT (FNF) cassette. This strain was maintained on a mixed C57BL/6 - 129 genetic background by the donating lab.

 

6.       Stock # 028317 STOCK Fzd10tm1.1Nat/J

Detailed Description

Fzd10 (frizzled homolog 10 (Drosophila)) coding region sequences are flanked by loxP sites in this Fzd10-CKO-AP allele. Cre-mediated recombination of the floxed region creates a knockout of the gene and enables expression of the alkaline phosphatase coding region under the control of the Fzd10 promoter.

 

Homozygous floxed mice have no apparent phenotype and are healthy and fertile. Expression of Fzd10 mRNA and protein have not been examined directly. Expression of the conditional reporter (alkaline phosphatase) has been examined histochemically.

 

Development

LoxP sites were inserted (1) within the first coding exon 5' of the initiator methionine codon, and (2) 3' of an SV40 polyadenylation signal that was inserted immediately 3' of the 3' UTR. The following DNA segments were added immediately downstream of the 3' loxP site: (1) the coding region for human placental alkaline phosphatase (AP), and (2) a phosphoglycerate kinase (PGK)-Neo cassette flanked by FRT sites (FNF). The targeting construct was electroporated into 129-derived ES cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Resulting chimeric males were crossed to C57BL/6 mice and then germline Flp mice (see Stock No. 003800) to excise the FRT-PGK-Neo-FRT (FNF) cassette. This strain was maintained on a mixed C57BL/6 - 129 genetic background by the donating lab.

 

 

Patent Information:
Inventors:
Category(s):
Get custom alerts for techs in these categories/from these inventors:
For Information, Contact:
Licensing Biomaterials
JHTVBioMaterials@jhu.edu
410-614-0300
Save This Technology:
2017 - 2022 © Johns Hopkins Technology Ventures. All Rights Reserved. Powered by Inteum